The genetic code of any organisms comprises of three nucleotides, also

The genetic code of any organisms comprises of three nucleotides, also

hwk3.seq
AGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC

1. The genetic code of any organisms comprises of  three nucleotides, also known as codon. Many gene-finding programs rely  on translating a piece of DNA sequence in all possible reading frames  and looking for the longest non-interrupted region of translation.  Please develop a Java program to read in a piece of DNA sequence from a  sequence file (hwk3.seq) (alternatively you can use the getRandomSeq(long) method of the RandomSeq  class to generate a piece of DNA sequence, see week#4 conference), and  then print out all the codons in three forward reading frames. Design a  method called codon() that can be used to find  all the codons from three reading frames. The method will take in an  argument, the reading frame (1, 2, or 3), and return an array or  ArrayList with all the codons. All the codons should have three  nucleotides, please discard the last one if it does not have three  nucleotides. Below is a sample output of the program: (5 points) 
Please enter the file name contains the DNA sequence: 
hwk3.seq 
The DNA sequence is: 
TCAGCGAGATGGGAAAGATCACCTTCTTCGAGGACCGAGGCTTCCAGGGC 
Reading frame #1 codons are: 
TCA GCG AGA TGG GAA AGA TCA CCT TCT TCG AGG ACC GAG GCT TCC AGG 
Reading frame #2 codons are: 
CAG CGA GAT GGG AAA GAT CAC CTT CTT CGA GGA CCG AGG CTT CCA GGG 
Reading frame #3 codons are: 
AGC GAG ATG GGA AAG ATC ACC TTC TTC GAG GAC CGA GGC TTC CAG GGC

 

Looking for a Similar Assignment? Order now and Get 10% Discount! Use Coupon Code “Newclient”

The post The genetic code of any organisms comprises of three nucleotides, also appeared first on Savvy Essay Writers.


The genetic code of any organisms comprises of three nucleotides, also was first posted on July 3, 2020 at 4:42 pm.
©2020 “Savvy Essay Writers”. Use of this feed is for personal non-commercial use only. If you are not reading this article in your feed reader, then the site is guilty of copyright infringement. Please contact me at savvyessaywriters@gmail.com

Our writing company helps you enjoy campus life. We have committed and experienced tutors and academic writers who have a keen eye in writing papers related to Business, Management, Marketing, History, English, Media studies, Literature, nursing, Finance, Medicine, Archaeology, Accounting, Statistics, Technology, Arts, Religion, Economics, Law, Psychology, Biology, Philosophy, Sociology, Political science, Mathematics, Engineering, Ecology etc.

Need Custom Written Paper?

-Plagiarism free

-Timely delivery